10 de juliol 2012

[Marcapáginas] Sorteos 74, 75 i 76 (y vacaciones!)

Tres sorteos seguidos por tres martes de ausencia. ((((Por si no lo he dicho mil veces, lo vuelvo a decir: me voy de vacaciones a Tailandia!!!)))

Como hay poca participación al ser verano, aprovechad, que seguro que os toca algo :) tres sorteos son tres sorteos... además es que son bonitos eh!!!!
POR CIERTO! el ganador de la setmana passada es Jordi.

Sorteo 74 (10 de julio)
Editorial Anthropos:





Sorteo 75 (17 de julio)
El Rompecabezas, colección sabelotod@s.
Newton, Einstein, Platón, Curie Atómica y Pasteur y sus vacunas.




Sorteo 76 (24 de julio)
Norma Editorial. Marcapáginas de cómics, que para mí son de los de top ten, me encantan :)


I un sorteo plus. Des de hace unos pocos meses en el Liceu hacen marcapáginas de sus obras. Aquí os dejo tres que tengo repetidos y que también voy a sortear.



Conclusión, 4 sorteos, 4! Y para participar sólo hace falta dejar un comentario.
Ah! Indicad que pack quereis (si sólo os interesa uno), o que orden de preferencia tenéis (si quereis optar a todos pero unos os gustan más que otros). Si sólo poneis un comentario y nada más, interpretaré que os da igual uno que otro :)

Feliz verano!
Nos vemos el dia 25!


39 comentaris:

Anònim ha dit...

Estreno comentari.

M'agraden tots però posats a escollir
primer els de Sabelotodo i després Norma
i desprès els altres.

Bones vacances a tothom.

Margarita de Manresa

Anònim ha dit...

Hola Eli,
aun no te has ido a Tailandia?,
ten cuidado que por allí hay mucho cocodrilo suelto y a ver si te muerde alguno y en vez de volver Eli vuelve media Eli.
Yo me apunto a todos los sorteos.
Felices vacaciones a todos los que vayais a algun sitio bonito y que os lo paseis muy bien.

Saludos a todos,
Carlos Vidal

Anònim ha dit...

HOLA ELI!

ES LA 1A VEGADA QUE PARTICIPO EN ELS TEUS SORTEJOS. FINS ARA NO SABIA QUE EN FEIES :-( :-(
DE TOTS AQUETS PUNTS QUE ENSENYES, JO PRIMER TRIARIA ELS DEL LICEU I DESPRÉS ELS DE "EL ROMPECABEZAS"... SUPOSO QUE JA DEUS ESTAR A PUNTS DE MARXAR A L'ALTRA PUNTA DEL MÓN EH? AISSSS QUINA ENVEJA QUE EM FAS PUNYETERA JEJEJE!!! QUE VAGIN MOOOLT BÉ LES VACANCES. QUAN TORNIS, JA EM DIRAS ALGO OK? BON VIATGE!!!

Anònim ha dit...

HOSTIII M'HE DESCUIDAT DE POSAR AL MEU COMENTARI ANTERIOR QUE SÓC LA LAURA (de Manresa) aisss on dec tenir al cap? jejeje

Goretti ha dit...

Me apunto al sorteo por el pack de Editorial Anthropos y de Editorial Norma. Los sabelotodos ya los tengo y el Liceu no es mi tema.
Que disfrutes mucho en tu viaje.
Saludos

Anònim ha dit...

Hola, me apunto al sorteo ¿ a cual? a cualquiera, no soy escrupuloso.
Por cierto, Eli, no te preocupes por los cocodrilos, no se comen cualquier cosa......
Saludos desde Aranjuez. Javier.

irati ha dit...

M'apunto al sorteig de Rompecabezas, ja que hi han 2 que em falten: Platon i Madame Curie, també al de Norma.

Bones vacances i fins la tornada !!!!

IRATI

Paula ha dit...

Hola, me apunto al sorteo de los del Liceu y los de Anthropos. (De Norma sólo me falta el de Pandora Hearts).
¡Felices vacaciones y buen viaje!

Anònim ha dit...

HOla
Me apunto a todos, pero prefiero el rompecabezas y en 2º lugar los de Norma.
Felices vacaciones!!!
Remei

Maria ha dit...

Bon dia!!

Primer de tot, bones vacances!!

Torno a participar al sorteig, posats a triar, primer prefereixo els de Norma Editorial i després els que formen un puzzle..la resta, no m'importa l'ordre :)

A veure si hi ha sort!!

Anònim ha dit...

Molt bones vacances, la millor època de l'any!!!!!
Jo nomes m'apunto al sorteig del Rompecabezas.
Pasat-ho molt be.
A reveure...
Pere C.

Isabel ha dit...

Hola Eli!! :)
Me apunto al sorteo. Mis preferidos son: 1)El Rompecabezas, 2)Norma Editorial, 3)Liceu y 4) Anthropos.
¡¡Disfruta las vacacionesss!!!
Saludos

Anònim ha dit...

Hola Eli! Estás que tiras la casa por la ventana! Vaya bonitos que son todos. Yo te indico mi orden de preferencia no obstante:

1ª Norma editorial
2º Liceu
3º Sabelotodos
4ª Anthropos

Gracias por estos concursos y que pases unas muy buenas vacaciones! Yolanda A.

Anònim ha dit...

Hola
Tinc algun de cada sorteig..
Ben pensat m´apunto a tots
i que la sort trii el que
volgui!!!
Bones merescudes vacances!!!
Salutacions.
Roser

Anònim ha dit...

Cuac Cuac
Como reflexion animal (que no personal), al margen de este consurso, y retomando a la C.A.P.C.H.A como elemento de seguridad, ¿sabemos quien ha sido el matao que se ha dedicado a fotografiar los numeritos de las calles?¿cobra por número, por manzana, por calle, por barriada?

Si es que hay gente "pa" tó (pues no te digo que los hay que se van hasta Tailandia, ya no digo a La Montgoda ó a Blanes, no, a Tailandia.....).
Alazos

Anònim ha dit...

Como soy acaparadora me apunto a todos . Eli que te lo pases muy bien. La Bruixa del punt

Anònim ha dit...

Cuac Cuac Cuac Cuac Cuac Cuac Cuac

¡¡¡Emi, cuanto tiempo!!!

Eres cruel ¿Por qué nos castigas con tu silencio?¿o es que quieres acaparar todos los punts de las próximas trobadas?
Dinos algo,porfa, porfa porfa.
Alazos, me piro que está preparando la escoba en posición de ataque.
Bruixot, ¿andandas?
Pato.

MC col·leccions ha dit...

Hola Eli, estaràs distreta pels mons de Deu... ja veus aqui seguim en la mateixa rutina de sempre.Veus l'estima del Javier, concursa per tu en Mondopunt, aixó son amics i lo demes son tonteries . Salutacions i fins aviat. Conxi i Miquel

Jordi i Carmen ha dit...

Hola Eli
Espero estiguis pasanto bé per Thailandia.
Com pots veure per aqui continuem tots amb el nostre problema de comunicació entre animals (patos, cocodrils etc.) i altre gent.
M'apunto a tots menys els del Liceo que ja els tinc.
JORDI

Anònim ha dit...

¿QUAN SORTIRÀ EL RESULTAT D'AQUEST SORTEIG? ¿ALGÚ M'HO POT DIR? GRACIES (Laura, Manresa)

Anònim ha dit...

Hola Eli:
Espero que te lo esres pasando muy bien, pero no te olvides de nosotros
y vuelve.
Me apunto a los cuatro sorteos. Suerte a todos.
Carmen

Anònim ha dit...

CUAC CUAC, Laura de Manresa

Pero vamos a ver, reina, ¿tú te piensas que aqui la turista va a hacer un sorteo cada semana?

Luego nos dirá que la culpa ha sido del Random, del Capcha, del Cocodrilo o de la diferencia horaria, pero vamos, hoy martes 17 ya debería haber un ganador.
Pero claro.....
¿Pues sabes lo que te digo?

QUE EL GANADOR DEL SORTEO Nº 74 DEL 10 DE JULIO ES....¡¡¡PATO!!!

Ale, hasta la semana que viene (eso quisieran algunos...)cuacuacuacuacuacuacuacuac
Collverd.

Anònim ha dit...

Eeii "PATO" CUAC CUAC... que amb la teva resposta m'he quedat igual :-( :-( ¿quan se sabrà el resultat d'aquests sortejos? i posats a preguntar més coses, ¿ALGÚ SAP EL MAIL D'UN NOI QUE ES DIU "PINI"? (he de contactar amb ell però no sé el seu mail bbrr)

EN FI, A VEURE SI ALGÚ EM POT AJUDAR, GRÀCIES (LAURA, Manresa)

Anònim ha dit...

Cuac cuac.
Venga, va..........en serio... por una sóla vez y sin que sirva de precedente.
Ante las dudas surgidas en este blog sobre el día en que se realizarán los sorteos y para tranquilidad de los participantes, me acaba de decir un pajarito al oido que el sorteo se celebrará el martes día 31 de Julio.
¿Capicci tutti?. Pues venga, alazos.Pato.

Anònim ha dit...

cua cuac Laura de Manresa
Oye, yo te he dicho cuando se celebra el sorteo; ahora que nos oye nadie, cuéntame qué apaños te traes con el Pini, anda pillina...
alazos.Pato.

Anònim ha dit...

Hola Eli!
a mi m'agraden tots, pero els de rompecabezas són els que més.
Que tinguis molt bones vacances, i que ho passis molt bé.

Gemma

Anònim ha dit...

HOLA PATO... UNA CURIOSIDAD, ¿TU DE DONDE ERES Y A QUE VIENE ESO DE QUE TE LLAMEN PATO?

1... GRACIAS POR DECIRME EL DIA DEL SORTEO, señor Pato jejeje
2... lo de buscar el mail de un chico que se llama PINI era por hacer intercambio de marcapáginas....no seas mal pensado eh?

juass vinga records a tothom i a veure si la Eli torna aviat jejeje. (LAURA, Manresa)

Anònim ha dit...

Cuac Cuac Laura de Manresa

Acercate por el Blog de MC que para lo que me pagas no voy a escribir dos veces; allí tienes la respuesta a todas tus tudas, menos la principal: Pini sigue desaparecido.

Alazos. Pato

Anònim ha dit...

EJEM EJEM SENYOR PATO... HO SENTO PERÒ M'AGRADA DIR "SENYOR" AL PATO CUAC CUAC.... YO NO TE PAGO NAAAAA QUE YO SEPA JAJA ADEMAS TUS ACALARACIONES QUE, POR CIERTO, AGRADECÍ MUCHO, YA SON A CAMBIO DE LA "CLASECITA PARTICULAR" QUE TE DÍ DE COMO SE COPIA UN TEXTO DEL PC EN VARIOS SITIOS A LA VEZ PARA QUE AL SEÑORITO CUAC CUAC NO LE DUELA EL PICO Y LAS ALITAS AL TENER QUE TECLEAR ESAS TECLAS DEL PC PARA COPIAR Y PEGAR UN TEXTO JAJAJA ALEEEE TOMAAA ESAA NEEENNN CUAAC CUACCCC (Laura)

Anònim ha dit...

cuac cuac Laurita de Manresa.
¿ asi que toma esa nennnnnn?
¿ sabes que puedo llegar a ser la peor de tus pesadillas?
Por cierto; ¿para cuando el proximo intercambio con Pino (uyyyy, perdon Pini, ¿donde tendria yo la cabeza?).
adeu.Pato.

Anònim ha dit...

Cuac Cuac

Dedicado a Miss Tailandia:

Revisado Blog a las 7.54 horas del lunes día 23 de Julio, no se detecta actividad normal. (paranormal toda la que quieras y más, ¿verdad, Manresana?).

Sequiré incordiando para que el Random no ser apolille.

(¡ya te vale marcharte sin Wifi y tener que chupar conexión hotelera como una vulgar vampira!¡qué verguenza, señor, qué verguenza!)
Ale, adiós. Pato

Anònim ha dit...

AT. SENYOR PATO: 1... NO EM DIGUIS "LAURITA" PORFA QUE HO ODIO!!!
2... NO SABIA QUE ESCRIBIA A TRAVÉS D'UN MÒBIL I NO D'UN PC... "SORRY"
3... ¿NO TINDRÀ PAS PER CASUALITAT VOSTÈ UN BLOG I ALGUN ALBUM A PICASSA? I POSATS A DEMANAR, ¿I SI EM DÓNA EL SEU MAIL? (AIXÍ TOT SERIA MÉS COMODE), GRÀCIES!! (Laura) :-) :-)

Anònim ha dit...

Cuac Cuac
Vete al MC, anda, vete al otro blog que luego la Ramirez me infla por estar por aqui tocando los Randoms.
Aparte, esto está tancat.
Alazos. Pato.

Eli Ramirez ha dit...

Ya he vueltooo!

Como dice pato, el sorteo será el próximo martes :-)

Anònim ha dit...

Cuac Cuac
No sé por qué tanta prisa en volver..
¿qué pensabas, que te ibas a encontrar esto como no sé qué?
Ay, Señor....
Bueno, pues ya que estás aqui y saludas a la gente, olvidándote de los animales, yo, como tal, te deseo una feliz reentrada.
Alazos. Pato.

Senyal de plana ha dit...

Hola Eli m'interessa els de sabelotod@s i els de Norma.
Suposo que te has passat unes bones vacances... ja has trobat punts de llibre de papiroflèxia a Tailàndia?
Una abraçada.
Jaume.

Eli Ramirez ha dit...

Pato, QUERIDO, lo siento!

...


(ha sonado muy falsa mi disculpa???)

:-)

mañana vuelvo a poner esto en funcionamiento. Es que llegar, situarse, fiestas locales, sol y playa... ya sabes, una se despista.


Jaume: papiroflèxia? no! no gaire cosa, quasi gens.........

Senyal de plana ha dit...

En vaig etivocar de país, els de papiroflexia eren del Vietnam.

osboma ha dit...

Hola M´apunto al sorteig 74. Que t´ho passis molt bè i portat molts marcapàginas.

LinkWithin

Related Posts with Thumbnails